View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21269_high_30 (Length: 240)

Name: NF21269_high_30
Description: NF21269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21269_high_30
NF21269_high_30
[»] chr2 (1 HSPs)
chr2 (20-225)||(33841239-33841444)


Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 225
Target Start/End: Original strand, 33841239 - 33841444
Alignment:
20 tgaaattggattgatccagaattttcacatattcgccatgcaatcagagtcaatggttgttttccgatcccacacaaagaacatagtttaatttttatgg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||    
33841239 tgaaattggattgatccagaattttcacatattcgccatgcaatcagagtcaatggttgttttccgatctcacacaaaaaacatagtttaatttttatgg 33841338  T
120 tatatacgttaaaataccgtgcgaaaattaacaccttccaattatggtttaatgatcaatgtcgatgaccaaatgctttcgataccgatacgcaacgggg 219  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
33841339 tatatacgttaaaataccgtgcgaaaattaacaccttccaattttggtttaatgatcaatgtcgatgaccaaatgctttcgatatcgatacgcaacgggg 33841438  T
220 gagcat 225  Q
    ||||||    
33841439 gagcat 33841444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University