View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21269_high_7 (Length: 470)
Name: NF21269_high_7
Description: NF21269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21269_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 403; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 30 - 452
Target Start/End: Original strand, 35074829 - 35075251
Alignment:
| Q |
30 |
gatcaaaatctactaaacgacgacgatgacggtgccgtttcttccgtttcgccggttccgaacgaaacaacaacacgacgtcgtttaccgctacgaacgc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35074829 |
gatcaaaatctactaaacgacgacgatgacggtgtcgtttcttccgtttcgccggttccgaacgaaacaacaacacgacgtcgtttaccgctacgaacgc |
35074928 |
T |
 |
| Q |
130 |
tgatgtttgaagaaagcagcgaagctacggcatcgtgttcatcttcaaccgacgagagtgtcgacctagaaggcgtagcggaagggagttattgcgtgtg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
35074929 |
tgatgtttgaagaaagcagcgaagctacggcatcgtgttcatcttcaaccgacgagagtatcgacctagaaggcgtagcggaagggagttactgcgtttg |
35075028 |
T |
 |
| Q |
230 |
gaaccctaattcggttggaattgagcgaaagaagagtagttcagcaggttcaggatcgaagcggtggaagctacggaacttgcttttgaggagtcatagc |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35075029 |
gaaccctaattcggttggaattgagcgaaagaagagtagttcagcaggttcaggatcgaatcggtggaagctacggaacttgcttttgaggagtcatagc |
35075128 |
T |
 |
| Q |
330 |
gatgggaaggataaacaaccggtgatgtttcagattccgaagacgacggcgagtaaagtgtcgccggcggtggagaatgacggtggaaagaatcagagta |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35075129 |
gatgggaaggataaacaaccggtgatgtttcagattccgaagacgacggcgagtaaagtgtcgccggcggtggagaatgacggtggaaagaatcagagta |
35075228 |
T |
 |
| Q |
430 |
agaggaagtcgtttttgccttac |
452 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
35075229 |
agaggaagtcgtttttgccttac |
35075251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University