View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21269_low_29 (Length: 244)
Name: NF21269_low_29
Description: NF21269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21269_low_29 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 9 - 244
Target Start/End: Original strand, 36965707 - 36965942
Alignment:
| Q |
9 |
gataatacttaatataaaacctcagtcattttattctgtttagtttgttggttatatatagagttctagtaggtcaagtggttgaactcaaatggttaat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36965707 |
gataatacttaatataaaacctcagtcattttattctgtttagtttgttggttatatatagagttctagtaggtcaagtggttgaactcaaatggttaat |
36965806 |
T |
 |
| Q |
109 |
aaacaacagtttatggttataaatagagttcgagctctgaccgttacaannnnnnnaccggactttacttacctccttgactaatgactgcactccatat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36965807 |
aaacaacagtttatggttataaatagagttcgagctctgaccgttacaatttttttaccggactttacttacctccttgactaatgactgaactccatat |
36965906 |
T |
 |
| Q |
209 |
taacatggtctctttctcccggcaaccggaggatta |
244 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
36965907 |
taacatggtccctttctcccggaaaccggaggatta |
36965942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University