View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21269_low_35 (Length: 233)
Name: NF21269_low_35
Description: NF21269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21269_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 101 - 216
Target Start/End: Original strand, 25377736 - 25377851
Alignment:
| Q |
101 |
taacacttcttggcatagttgtttgaagaaattgaagtggtgatcaaattaatccatgctgtttagagtagtataatgattactcatgtttggtctacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25377736 |
taacacttcttggcatagttgtttgaagaaattgaagtggtgatcaaattaatccatgctgtttagagtagtataatgattactcatgtttggtctacaa |
25377835 |
T |
 |
| Q |
201 |
tagttataagcttcat |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
25377836 |
tagttataagcttcat |
25377851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 29 - 97
Target Start/End: Original strand, 25377637 - 25377705
Alignment:
| Q |
29 |
ttaaaacattttaccaatgtatagtctgcattaaatccatcattctcatttacatgctttgtttttgtc |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25377637 |
ttaaaacattttaccaatgtatagtctgcattaaatccatcattctcatttacatgctttgtttttgtc |
25377705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University