View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2126_high_20 (Length: 248)
Name: NF2126_high_20
Description: NF2126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2126_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 9 - 70
Target Start/End: Original strand, 1250700 - 1250761
Alignment:
| Q |
9 |
attatactctctgctatcattatgacaagaaaaaactctattttagattcattgaacaactg |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1250700 |
attatactctctgctatcattatgacaagaaaaaactctattttagattcattgaacaactg |
1250761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 153 - 248
Target Start/End: Original strand, 1250831 - 1250926
Alignment:
| Q |
153 |
ctcttagaaggggaataccgtacaagtagtctatgaagannnnnnnnnnataattttagaataataaataaaaatgggatagactcaactcatcca |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1250831 |
ctcttagaaggggaataccgtacaagtagtctatgaagacgttttttttataattttagaataataaataaaaatgggatagactccactcatcca |
1250926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University