View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2126_low_23 (Length: 250)
Name: NF2126_low_23
Description: NF2126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2126_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 50014668 - 50014424
Alignment:
| Q |
1 |
tttcgtaacacaataagtgttgaaattgtaccaagagatagtaaagaaaatataaactaacctcctgttcagtctcacatagtgaacatatcacctgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50014668 |
tttcgtaacacaataagtgttgaaattgtaccaagagatagtaaagaaaatataaactaacctcctgttcagtctcacatagtgaacatatcacctgaaa |
50014569 |
T |
 |
| Q |
101 |
agttaagagcacttattaccattgcctcatcagaaaaataacaacagcaaaagcgatcacaaaattgcagatcttcaatgaggtgttaaaatagacgaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50014568 |
agttaagagcacttattaccattgcctcatcagaaaaataacaacagcaaaagcgatcacaaaattgcagatcttcaatgaggtgttaaaatagacgaac |
50014469 |
T |
 |
| Q |
201 |
atacttgtttgacttgatggcggggaatgtcgtgcctatgcttct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50014468 |
atacttgtttgacttgatggcggggaatgtcgtgtctatgcttct |
50014424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University