View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21271_high_5 (Length: 252)
Name: NF21271_high_5
Description: NF21271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21271_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 12560531 - 12560289
Alignment:
| Q |
1 |
gttaacatgttcgcgccactatggacatcaaaattgttgtttatgttgtatggtgtattgttggtggtgaccgtcgttgtaccacttggtaaaccattat |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12560531 |
gttaacatgttcgcgtcactatggacatcaaaattgttgtttatgttgtatggtgtattgttggtggtgaccgtcgttgtaccacttggtaaaccattat |
12560432 |
T |
 |
| Q |
101 |
tagtggcggtggctagggtggcggaggtggatgcggcagcttggatgcgctccactagccttggcatccaaaggtatcgcatagcatctttaaattgctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12560431 |
tagtggcggtggctagggtggcggaggtggatgcggcagcttggatgcgctccactagccttggcatccaaaggtatcgcatagcatctttaaattgctt |
12560332 |
T |
 |
| Q |
201 |
gctgtttacgtcacatttgagttgtttggcatattcttggaca |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
12560331 |
gctgtttacgtcacatttgagttgtttggcatgtttttggaca |
12560289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 133 - 231
Target Start/End: Original strand, 50777386 - 50777484
Alignment:
| Q |
133 |
gcggcagcttggatgcgctccactagccttggcatccaaaggtatcgcatagcatctttaaattgcttgctgtttacgtcacatttgagttgtttggca |
231 |
Q |
| |
|
||||| ||||| || || || ||||||||||||||||||||||| ||||| | || || ||||||||||| || ||||| |||||||||||||||||| |
|
|
| T |
50777386 |
gcggcggcttgaatacgttcgactagccttggcatccaaaggtagcgcatggtgtccttgaattgcttgctattcacgtcgcatttgagttgtttggca |
50777484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University