View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21271_low_5 (Length: 252)

Name: NF21271_low_5
Description: NF21271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21271_low_5
NF21271_low_5
[»] chr2 (1 HSPs)
chr2 (1-243)||(12560289-12560531)
[»] chr4 (1 HSPs)
chr4 (133-231)||(50777386-50777484)


Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 12560531 - 12560289
Alignment:
1 gttaacatgttcgcgccactatggacatcaaaattgttgtttatgttgtatggtgtattgttggtggtgaccgtcgttgtaccacttggtaaaccattat 100  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12560531 gttaacatgttcgcgtcactatggacatcaaaattgttgtttatgttgtatggtgtattgttggtggtgaccgtcgttgtaccacttggtaaaccattat 12560432  T
101 tagtggcggtggctagggtggcggaggtggatgcggcagcttggatgcgctccactagccttggcatccaaaggtatcgcatagcatctttaaattgctt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12560431 tagtggcggtggctagggtggcggaggtggatgcggcagcttggatgcgctccactagccttggcatccaaaggtatcgcatagcatctttaaattgctt 12560332  T
201 gctgtttacgtcacatttgagttgtttggcatattcttggaca 243  Q
    |||||||||||||||||||||||||||||||| || |||||||    
12560331 gctgtttacgtcacatttgagttgtttggcatgtttttggaca 12560289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 133 - 231
Target Start/End: Original strand, 50777386 - 50777484
Alignment:
133 gcggcagcttggatgcgctccactagccttggcatccaaaggtatcgcatagcatctttaaattgcttgctgtttacgtcacatttgagttgtttggca 231  Q
    ||||| ||||| || || || ||||||||||||||||||||||| ||||| |  || || ||||||||||| || ||||| ||||||||||||||||||    
50777386 gcggcggcttgaatacgttcgactagccttggcatccaaaggtagcgcatggtgtccttgaattgcttgctattcacgtcgcatttgagttgtttggca 50777484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University