View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21272_low_9 (Length: 240)
Name: NF21272_low_9
Description: NF21272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21272_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 64 - 122
Target Start/End: Original strand, 39102660 - 39102718
Alignment:
| Q |
64 |
ctgctaggagcatttaatcttaaatcaataaggacaaagaataagttcaccacattctg |
122 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39102660 |
ctgctaggggcatttaatcttaaatcaataaggacaaagaataagttcaccacattctg |
39102718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 198 - 230
Target Start/End: Original strand, 39102794 - 39102826
Alignment:
| Q |
198 |
tgatgttatatgtttcttaatttaattattcat |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39102794 |
tgatgttatatgtttcttaatttaattattcat |
39102826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University