View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21273_high_4 (Length: 263)
Name: NF21273_high_4
Description: NF21273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21273_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 180
Target Start/End: Complemental strand, 38627234 - 38627072
Alignment:
| Q |
18 |
acgatctccctcgccggttcaacgtcggaatgctcgacggccggaacacaacggaagctccggtgaccattgctgattatccgctgtggcctgataatca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38627234 |
acgatctccctcgccggttcaacgtcggaatgctcgacggccggaacacaacggaagctccggtgaccattgctgattatccgctgtggcctgataatca |
38627135 |
T |
 |
| Q |
118 |
gggtttgaggaggcagcatagtgtaccgtactggatgatgggctcgcttcttagcggcggtgg |
180 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |||||||||| ||| ||||| |
|
|
| T |
38627134 |
gggtttgaggaggcagcatagtgtagagtactggatgatgggttcgcttcttaacggtggtgg |
38627072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University