View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21273_high_4 (Length: 263)

Name: NF21273_high_4
Description: NF21273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21273_high_4
NF21273_high_4
[»] chr3 (1 HSPs)
chr3 (18-180)||(38627072-38627234)


Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 180
Target Start/End: Complemental strand, 38627234 - 38627072
Alignment:
18 acgatctccctcgccggttcaacgtcggaatgctcgacggccggaacacaacggaagctccggtgaccattgctgattatccgctgtggcctgataatca 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38627234 acgatctccctcgccggttcaacgtcggaatgctcgacggccggaacacaacggaagctccggtgaccattgctgattatccgctgtggcctgataatca 38627135  T
118 gggtttgaggaggcagcatagtgtaccgtactggatgatgggctcgcttcttagcggcggtgg 180  Q
    |||||||||||||||||||||||||  ||||||||||||||| |||||||||| ||| |||||    
38627134 gggtttgaggaggcagcatagtgtagagtactggatgatgggttcgcttcttaacggtggtgg 38627072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University