View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21273_low_4 (Length: 285)
Name: NF21273_low_4
Description: NF21273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21273_low_4 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 57 - 285
Target Start/End: Original strand, 12312411 - 12312635
Alignment:
| Q |
57 |
ctaacatcatcaatgataaacttgtaaaaaacatgcatagcgcagtcacatagttttttggtttaggtgaatttccatggctttaaggatttttcccttc |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12312411 |
ctaacatcatcaatgataaacttgtaaaaaatat----agcgcaatcacatagttttttggttcaggtgaatttccatggctttaaggatttttcccttc |
12312506 |
T |
 |
| Q |
157 |
tttgttctttcattactttttgagaaatttatttacaaaactaaactaaaacaaacataaaatacctacttctatgccacgatgatactaaatcatgacc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
12312507 |
tttgttctttcattactttttgagaaatttatttacaaaactaaactaaaacaaacataaaatacctgcttctatgccacaatgatactaaatcatgacc |
12312606 |
T |
 |
| Q |
257 |
aaaaaccctatattatttcttgtcatcac |
285 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12312607 |
aaaaaccctatattatttcttgtcatcac |
12312635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University