View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21274_low_2 (Length: 379)
Name: NF21274_low_2
Description: NF21274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21274_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 142 - 363
Target Start/End: Complemental strand, 9032146 - 9031925
Alignment:
| Q |
142 |
aacatgcaaataaactaataggataaaattctcatctatactaatttccgatgcaaacatagacaaatgcaaaaatatatcaaaatagatataatataag |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9032146 |
aacatgcaaataaactaataggataaaattctcatctatactaatttccgatgcaaacatagacaaatgcaaaaatatatcaaaatagatataatataag |
9032047 |
T |
 |
| Q |
242 |
tactttggatttttcaatactgtaattatacaaatcatcacaagtggagtttattgctactttctagaataacgaatggatatcaatgtacaagatatat |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9032046 |
tactttggatttttcaatactgtaattatacaaatcatcacaagtggagtttattgctactttctagaataacgaatggatatcaatgtacaagatatat |
9031947 |
T |
 |
| Q |
342 |
ggatgaccaacataacatgcaa |
363 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
9031946 |
ggatgaccaacataacatgcaa |
9031925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 23 - 85
Target Start/End: Complemental strand, 9032265 - 9032203
Alignment:
| Q |
23 |
gggccgcatattctagagctcggtccgacctgtgtgggccatggaccagctcggctcggcccg |
85 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
9032265 |
gggccgcatattcttgagctctgtccgacctgtgtgggccatgggccagcccggctcggcccg |
9032203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 24 - 65
Target Start/End: Complemental strand, 12396946 - 12396905
Alignment:
| Q |
24 |
ggccgcatattctagagctcggtccgacctgtgtgggccatg |
65 |
Q |
| |
|
|||||||||||||||||| ||| ||| ||||||||||||||| |
|
|
| T |
12396946 |
ggccgcatattctagagcccggcccggcctgtgtgggccatg |
12396905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University