View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21275_high_21 (Length: 285)
Name: NF21275_high_21
Description: NF21275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21275_high_21 |
 | |
|
| [»] scaffold0215 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 151 - 275
Target Start/End: Original strand, 35902049 - 35902173
Alignment:
| Q |
151 |
gtgtttgttgtagttcttacatcttttggagatatggaaggattgattacatagcaatttctaatcaatccttaatttgtaggctttttgtcccatgcct |
250 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35902049 |
gtgtttgttgtagttcttacatcctttggagatatggaaggattgattacatagcaatttctaatcaatccttaatttgtagtctttttgtcccatgcct |
35902148 |
T |
|
| Q |
251 |
catccaaattacaatttgtcctttg |
275 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
35902149 |
catccaaattacaatttgtcctttg |
35902173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 16 - 95
Target Start/End: Original strand, 35901970 - 35902049
Alignment:
| Q |
16 |
atgatttctttgacaactaactgggctgtttcattttcaaatactgagtctacaacaacagttgataaatattttgatag |
95 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
35901970 |
atgatttctttgacaactaactggactgtctcattttcaaatactgagtctacagcaatagttgataaattttttgatag |
35902049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0215 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0215
Description:
Target: scaffold0215; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 126 - 189
Target Start/End: Original strand, 21300 - 21363
Alignment:
| Q |
126 |
agtagctgctacaataactcatgttgtgtttgttgtagttcttacatcttttggagatatggaa |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | ||||| ||||| |||||||| |
|
|
| T |
21300 |
agtagctgctacaataactcatgttgtgtttgttgtagttcatgcatctattggatatatggaa |
21363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University