View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21275_high_29 (Length: 250)

Name: NF21275_high_29
Description: NF21275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21275_high_29
NF21275_high_29
[»] chr3 (1 HSPs)
chr3 (1-242)||(342302-342543)
[»] chr1 (1 HSPs)
chr1 (15-80)||(31119998-31120064)


Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 342543 - 342302
Alignment:
1 aatgttggctgcaacatggcgttttatggcagcttaatatggtggtttttggctttccgccattcgcaatcgataacactagtttcaacccattccctgc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
342543 aatgttggctgcaacatggcgttttatggcagcttaatatggtggtttttggctttccgccattcgcaatcgataacactagtttcaacccattccctgc 342444  T
101 aattgacacactgatttcattccattccacatcattccatgattgcatcccttaccaccaatccaaacataactgagccctttctatagttgagctgata 200  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
342443 aattgatacactgatttcattccattccacatcattccatgattgcatcccttaccgccaatccaaacataactgagccctttctatagttgagctgata 342344  T
201 ctcagtttccaaatgataaaaattcaacgtgtcccctatgct 242  Q
    |||||||||||||||||||||||||||| |||||||| ||||    
342343 ctcagtttccaaatgataaaaattcaacttgtcccctctgct 342302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 80
Target Start/End: Original strand, 31119998 - 31120064
Alignment:
15 catggcgttttatggcagcttaatatggt-ggtttttggctttccgccattcgcaatcgataacact 80  Q
    ||||||||||||||||||||||| ||| | || |||||||||||| ||||  |||||| ||||||||    
31119998 catggcgttttatggcagcttaaaatgatgggcttttggctttccaccatctgcaatcaataacact 31120064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University