View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21275_high_29 (Length: 250)
Name: NF21275_high_29
Description: NF21275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21275_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 342543 - 342302
Alignment:
| Q |
1 |
aatgttggctgcaacatggcgttttatggcagcttaatatggtggtttttggctttccgccattcgcaatcgataacactagtttcaacccattccctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
342543 |
aatgttggctgcaacatggcgttttatggcagcttaatatggtggtttttggctttccgccattcgcaatcgataacactagtttcaacccattccctgc |
342444 |
T |
 |
| Q |
101 |
aattgacacactgatttcattccattccacatcattccatgattgcatcccttaccaccaatccaaacataactgagccctttctatagttgagctgata |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
342443 |
aattgatacactgatttcattccattccacatcattccatgattgcatcccttaccgccaatccaaacataactgagccctttctatagttgagctgata |
342344 |
T |
 |
| Q |
201 |
ctcagtttccaaatgataaaaattcaacgtgtcccctatgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
342343 |
ctcagtttccaaatgataaaaattcaacttgtcccctctgct |
342302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 80
Target Start/End: Original strand, 31119998 - 31120064
Alignment:
| Q |
15 |
catggcgttttatggcagcttaatatggt-ggtttttggctttccgccattcgcaatcgataacact |
80 |
Q |
| |
|
||||||||||||||||||||||| ||| | || |||||||||||| |||| |||||| |||||||| |
|
|
| T |
31119998 |
catggcgttttatggcagcttaaaatgatgggcttttggctttccaccatctgcaatcaataacact |
31120064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University