View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21275_high_37 (Length: 217)

Name: NF21275_high_37
Description: NF21275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21275_high_37
NF21275_high_37
[»] chr3 (1 HSPs)
chr3 (18-189)||(21389558-21389730)
[»] chr7 (2 HSPs)
chr7 (40-85)||(14971988-14972033)
chr7 (40-85)||(15401464-15401509)


Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 21389558 - 21389730
Alignment:
18 gtatccttatcttgtgtgcttacatttgcatgttcacttattttcaattgcgattgttacttgtgttgctataacttgtaattgtccacttattttactt 117  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
21389558 gtatccttatcttgtgtgcttacatttgcatgttcacttgttttcaattgcgattgttacttgtgttgttataacttgtaattgtccacttattttactt 21389657  T
118 aaattacttgtgttggttactatcc-ttttgacgttttcaaaggagggagaaatggttggatgatgtccttgt 189  Q
    ||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||| |||||||||    
21389658 aaattacttgtgttggttactatcctttttgacgttttcaaagggggaagaaatggttggatggtgtccttgt 21389730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 40 - 85
Target Start/End: Complemental strand, 14972033 - 14971988
Alignment:
40 catttgcatgttcacttattttcaattgcgattgttacttgtgttg 85  Q
    ||||||||||||||||| ||||||||||||||||| | ||||||||    
14972033 catttgcatgttcacttgttttcaattgcgattgtaaattgtgttg 14971988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 40 - 85
Target Start/End: Complemental strand, 15401509 - 15401464
Alignment:
40 catttgcatgttcacttattttcaattgcgattgttacttgtgttg 85  Q
    ||||||||||||||||| ||||||||||||||||| | ||||||||    
15401509 catttgcatgttcacttgttttcaattgcgattgtaaattgtgttg 15401464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University