View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21275_low_15 (Length: 354)
Name: NF21275_low_15
Description: NF21275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21275_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 20 - 350
Target Start/End: Complemental strand, 30804007 - 30803677
Alignment:
| Q |
20 |
tagaggaggtaccacaaactaccctataaccgaggttaagtcagttctaagtagcaactgtagcttaaactgttaaagctttctttttaactgtcatcat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30804007 |
tagaggaggtaccacaaactaccctataaccgaggttaagtcagttctaagtagcaactgtagcttaaactgttaaagctttctttttaattgtcatcat |
30803908 |
T |
 |
| Q |
120 |
atttttagtgggaaagcatggagagctgcgcattttgaaccttcagttacataatattaattttatggtacatacctaattatatggttcaaccattgag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30803907 |
atttttagtgggaaagcatggagagctgcgcattttgaaccttcagttacataatattaattttatggtacatacctaattatatggttcaaccattgag |
30803808 |
T |
 |
| Q |
220 |
atcaagattgagatgccttctatgctgctttaatttgtgacctttgtcctttggcttgcctcaaaggcatccaaaatgtatcattcctggcttaaactcg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30803807 |
atcaagattgagatgccttctatgctgctttaatttgtgacctttgtcctttggcttgcctcaaaggcatccaaaatgtatcattcctggcttaaactcg |
30803708 |
T |
 |
| Q |
320 |
atgaagagagctttctgtccctatgctactc |
350 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |
|
|
| T |
30803707 |
atgaagagagctttctgtccccatgctactc |
30803677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University