View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21275_low_17 (Length: 310)
Name: NF21275_low_17
Description: NF21275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21275_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 97 - 219
Target Start/End: Original strand, 42357334 - 42357456
Alignment:
| Q |
97 |
tatagcagtttagagtttaattttcatatattaccaaaacaatgcgcaaggaaagacacaaccacctaataactttgcgtttagttatagtttcaaccat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42357334 |
tatagcagtttagagtttaattttcatatattaccaaaacaatgcgcaaggaaagacacaaccacctaacaactttgcgtttagttatagtttcaaccat |
42357433 |
T |
|
| Q |
197 |
tattatctatcgtactagacaaa |
219 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
42357434 |
tatcatctatcgtactagacaaa |
42357456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 254
Target Start/End: Original strand, 42357785 - 42357814
Alignment:
| Q |
225 |
attaactgattatatactccttttaataaa |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42357785 |
attaactgattatatactccttttaataaa |
42357814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University