View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21275_low_20 (Length: 292)
Name: NF21275_low_20
Description: NF21275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21275_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 12 - 276
Target Start/End: Original strand, 7502349 - 7502613
Alignment:
| Q |
12 |
tgtgatggtatagcaaggagaatgttgtggtttttcatagaaagtttaacaagagcccttgagataattggtacagcattacctccattagcaaatatca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7502349 |
tgtgatggtatagcaaggagaatgttgtggtttttcatagaaagtttaacaagagcccttgagataattggtacagcattacctccattagcaaatatca |
7502448 |
T |
 |
| Q |
112 |
acaaaacattagcattagggttatctagagcccacagtgacatatcagtaataatctttttgtaacattcatcaaagtaactatcagagacgctagtgac |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7502449 |
acaaaacattagcattagggttacctagagcccacagtgacatatcagtaataatctttttgtaacattcatcaaagtaactatcagagacgctagtgac |
7502548 |
T |
 |
| Q |
212 |
gtgatggacggagatgcctgtggaggaaagcgcgtttagaatttcactggcgatgagattggtgt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7502549 |
gtgatggacggagatgcctgtggaggaaagcgcgtttagaatttcactggcgatgagattggtgt |
7502613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 276
Target Start/End: Original strand, 7499231 - 7499279
Alignment:
| Q |
228 |
cctgtggaggaaagcgcgtttagaatttcactggcgatgagattggtgt |
276 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
7499231 |
cctgtggaggaaataccgtttagaatttcactggagatgagattggtgt |
7499279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University