View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21275_low_25 (Length: 272)
Name: NF21275_low_25
Description: NF21275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21275_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 254
Target Start/End: Original strand, 37862739 - 37862974
Alignment:
| Q |
19 |
tctcaaagaacaaacagttcattagcaatgaactgtaaagggtgcatgtaaaaggaaagcaaaacactctagcataaagaaaaatgaaacttgattggac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37862739 |
tctcaaagaacaaacagttcattagcaatgaactgtagagggtgcatgtaaaaggaaagcaaaacactctagcataaagaaaaatgaaacttgattggac |
37862838 |
T |
 |
| Q |
119 |
atttgctgctagattaatgagttcctggtatgatatttacttaggatgattgcttccactgaactagtaatcaatcaacaaattccatattatcggctaa |
218 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
37862839 |
atttgctgctagattaatgaattcctggtatgatatttacttaggatgattgcttccactgaactagtaatcaatcaacaaactccgtattatcggctaa |
37862938 |
T |
 |
| Q |
219 |
gcactcagccatttcatatagatttttggaaccatg |
254 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37862939 |
gcactcagccatttcatataggtttttggaaccatg |
37862974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University