View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21275_low_26 (Length: 270)
Name: NF21275_low_26
Description: NF21275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21275_low_26 |
 |  |
|
| [»] chr6 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 244; Significance: 1e-135; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 15 - 270
Target Start/End: Original strand, 34933166 - 34933421
Alignment:
| Q |
15 |
atcaaaatcaaaatacttacatacatacctgcaaccctagaagaagaagtgtgtgtgtataaccgaaagagttagttatttgggctgaatgatattttca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34933166 |
atcaaaatcaaaatacttacatacatacctgcaaccctagaagaacaagtgtgtgtgtataaccgaaagagttagttatttgggctgaatgatattttca |
34933265 |
T |
 |
| Q |
115 |
agcccaagcctgagcctctctatttatgaatgaacatgtgccatttacacgagagaatattcaaacctctcctgttcttttttgtaagtgtttttcattg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34933266 |
agcccaagcctgagcctctctatttatgaatgaacatgtgccctttacacgagagaatattcaaacctctcctgttcttttttgtaagtgtttttcattg |
34933365 |
T |
 |
| Q |
215 |
ttttcatgccttcattacttgaaatcattccatgagagaacaacagaaagagacat |
270 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34933366 |
ttttcaagccttcattacttgaaatcattccatgagagaacaacagaaagagacat |
34933421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 44 - 124
Target Start/End: Original strand, 34926734 - 34926816
Alignment:
| Q |
44 |
tgcaaccctagaagaagaagtgt--gtgtgtataaccgaaagagttagttatttgggctgaatgatattttcaagcccaagcc |
124 |
Q |
| |
|
|||||||| ||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
34926734 |
tgcaacccgagaagaacaagtgtgtgtgtgtataaccgaaagagttagttatttgggctgaatgatatttccaaacccaagcc |
34926816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 225
Target Start/End: Original strand, 34926842 - 34926885
Alignment:
| Q |
181 |
ctctcctgttcttttttgtaagtgtttttcattgttttcatgcct |
225 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34926842 |
ctctcctgttctttt-tgtaagtgtttttcattgttttcatgcct |
34926885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University