View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21275_low_37 (Length: 220)
Name: NF21275_low_37
Description: NF21275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21275_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 16537808 - 16538013
Alignment:
| Q |
1 |
ccctggctcatacccagtagtctgaggccctgcattataaggataaccaccaggtggcaccgtttgaggccctgcattataaggataccctccaggtggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16537808 |
ccctggctcatacccagtagtctgaggccccgcattataaggataaccaccaggtggcgcagtttgaggccctgcattataaggataccctccaggtggc |
16537907 |
T |
 |
| Q |
101 |
gctgcagaataaccataattctgcggcggtgcaccataagggtttccatatccaggagcagagggattataattataatccttcgacgacgcctgaggtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16537908 |
gctgcagaataaccataattctgcggcggtgcaccataagggtttccatatccaggagcagagggattataattataatccctcgacgacgcctgaggtg |
16538007 |
T |
 |
| Q |
201 |
gaggaa |
206 |
Q |
| |
|
|||||| |
|
|
| T |
16538008 |
gaggaa |
16538013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University