View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21275_low_39 (Length: 207)

Name: NF21275_low_39
Description: NF21275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21275_low_39
NF21275_low_39
[»] chr8 (2 HSPs)
chr8 (128-191)||(15150723-15150786)
chr8 (11-62)||(15150606-15150657)


Alignment Details
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 128 - 191
Target Start/End: Original strand, 15150723 - 15150786
Alignment:
128 atctggtttgatatgaacagaggttgaaaacttattcagcaagtaatgaagccacctatatttt 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15150723 atctggtttgatatgaacagaggttgaaaacttattcagcaagtaatgaagccacctatatttt 15150786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 11 - 62
Target Start/End: Original strand, 15150606 - 15150657
Alignment:
11 gaagaatatatactaagttcgctaggccctcttttcttatgagcgtattttc 62  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
15150606 gaagaatatatactaagttcgctaggccctcttttcttatgagcgtattttc 15150657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University