View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21276_high_25 (Length: 271)
Name: NF21276_high_25
Description: NF21276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21276_high_25 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 72 - 271
Target Start/End: Complemental strand, 3895519 - 3895320
Alignment:
| Q |
72 |
ctttccaacaacagtctccttgatcttttgtgttgcatccttcgctgtctcccacgctccttgggccgtcttcttcgccatttccccagcactcttcaaa |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3895519 |
ctttccaacaacagtctccttgatcttttgtgttgcatccttcgctgtctcccacgctccttgggccgtcttcttcgccatttccccagcactcttcaaa |
3895420 |
T |
 |
| Q |
172 |
gcctctgtcgccgacccagcaacctcccccgtcttctctgccgttttctcagctccttcttttgtcttatcagccatgtaactcgctccttccttggttc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3895419 |
gcctctgtcgccgacccagcaacctcccccgtcttctccgccgttttctcagctccttcttttgtcttatcagccatgtaactcgctccttccttggttc |
3895320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 14 - 50
Target Start/End: Complemental strand, 3895574 - 3895538
Alignment:
| Q |
14 |
catcatctactactacaccagaaccaccactaccacg |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3895574 |
catcatctactactacaccagaaccaccactaccacg |
3895538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University