View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21276_high_28 (Length: 251)
Name: NF21276_high_28
Description: NF21276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21276_high_28 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 16947818 - 16948068
Alignment:
| Q |
1 |
tgaaacgtgtctttccaacaatatcacgtgtaaccacaacaagtggagcaaaaatacctttcccttcattaacattcttcatcataggttgcaacctcac |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16947818 |
tgaaacgtttctttccaacaatatcacgagtaaccacaacaagtggagcaaaaatacctttcccttcattaacattcttcatcataggttgcaacctcac |
16947917 |
T |
 |
| Q |
101 |
tggcttactaactcttccaatacgaagttgcgaagaaactgacttagtcaacatggtgtaatcttcaccaactatagaagttccccagcttccatagaat |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16947918 |
tggtttactaactcttccaatacgaagttgcgaagaaactgacttagccaacatggtgtaatcttcaccaactatagaagttccccagcttccatagaat |
16948017 |
T |
 |
| Q |
201 |
gatgaaccaacacaacctgttgcagaaattgaagtggccattttagttcct |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16948018 |
gatgaaccaacacaacctgttgcagaaattgaagtggccattttagttcct |
16948068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University