View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21276_high_32 (Length: 244)
Name: NF21276_high_32
Description: NF21276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21276_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 31127418 - 31127642
Alignment:
| Q |
1 |
atgagattctaaaggaagttatgggaaaatcggaaacggttaattacaatgaggtgaaggatatggtttacactcatgcggctttatgcgagagtatgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31127418 |
atgagattctaaaggaagttatgggaaaatcggaaacggttaattacaatgaggtgaaggatatggtttacactcatgcggctttatgtgagagtatgag |
31127517 |
T |
 |
| Q |
101 |
actgtatcctccggttcccgtggatggtaaggaagcggcttctgacgacgttttgccggatggaactttagtgaagaaagggtggagggtgacatatcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31127518 |
actgtatcctccggttcccgtggatggtaaggaagcggcttgtgacgacgttttgccggatggaactttagtgaagaaagggtggagggtgacatatcat |
31127617 |
T |
 |
| Q |
201 |
atatatgctatgggaaggtccgaga |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
31127618 |
atatatgctatgggaaggtccgaga |
31127642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 24 - 225
Target Start/End: Original strand, 31078123 - 31078324
Alignment:
| Q |
24 |
ggaaaatcggaaacggttaattacaatgaggtgaaggatatggtttacactcatgcggctttatgcgagagtatgagactgtatcctccggttcccgtgg |
123 |
Q |
| |
|
|||||||| |||| |||| |||| |||||||||||||||||||||| ||||||||| | |||||||||||||||||||| |||||||| ||||| |||| |
|
|
| T |
31078123 |
ggaaaatcagaaatagttagttacgatgaggtgaaggatatggtttatactcatgcgtcgttatgcgagagtatgagactttatcctccagttccagtgg |
31078222 |
T |
 |
| Q |
124 |
atggtaaggaagcggcttctgacgacgttttgccggatggaactttagtgaagaaagggtggagggtgacatatcatatatatgctatgggaaggtccga |
223 |
Q |
| |
|
|| ||| ||||| || | | || |||||||| ||||||||||| ||||||||||||||||| ||| | |||||||||||||||||||||||||| || |
|
|
| T |
31078223 |
atactaaagaagcagcgtacaatgatgttttgccagatggaacttttgtgaagaaagggtggagagtggcgtatcatatatatgctatgggaaggtcgga |
31078322 |
T |
 |
| Q |
224 |
ga |
225 |
Q |
| |
|
|| |
|
|
| T |
31078323 |
ga |
31078324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 49 - 225
Target Start/End: Original strand, 31132174 - 31132350
Alignment:
| Q |
49 |
atgaggtgaaggatatggtttacactcatgcggctttatgcgagagtatgagactgtatcctccggttcccgtggatggtaaggaagcggcttctgacga |
148 |
Q |
| |
|
||||||||||| ||||||||||||||||||| | |||||||||||||||||| || | ||||| ||| | ||||||| ||||||||| || | || || |
|
|
| T |
31132174 |
atgaggtgaagaatatggtttacactcatgcatcgttatgcgagagtatgagaatggaccctccagtttcagtggatgctaaggaagcagcctacgatga |
31132273 |
T |
 |
| Q |
149 |
cgttttgccggatggaactttagtgaagaaagggtggagggtgacatatcatatatatgctatgggaaggtccgaga |
225 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||| || | |||||| |||||| |||||||||||| |||| |
|
|
| T |
31132274 |
tgttttgccagatggaacattagtgaagaaagggtggatagttgcgtatcatgtatatgttatgggaaggtctgaga |
31132350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University