View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21276_high_36 (Length: 216)
Name: NF21276_high_36
Description: NF21276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21276_high_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 4 - 203
Target Start/End: Complemental strand, 7623482 - 7623284
Alignment:
| Q |
4 |
tatgacacgatggacgaatgtctatttgacaatgggattttgaatcatcttggtagtccagattgagcatgatgggttgctgtatggtaacacatggtat |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
7623482 |
tatgacacgatggacgaatgtctatttgacaatgggaatttgaatcatcttggtagtccagattgagcatgatgggctgctgtatggtaa-acatggtat |
7623384 |
T |
 |
| Q |
104 |
tctaggttcacgacaattgtctgttggtgttgcaaaccgattgtgtgtttgcataatacaatagtactaagtttattctcaatttgatgtttataaatga |
203 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7623383 |
tctaggttcatgacaattgtctgatggtgttgcgagccgattgtgtgtttgcataatacaatagtactaagtttattctcaatttggtgtttataaatga |
7623284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University