View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21276_low_22 (Length: 326)
Name: NF21276_low_22
Description: NF21276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21276_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 78; Significance: 3e-36; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 71 - 167
Target Start/End: Complemental strand, 43559537 - 43559440
Alignment:
| Q |
71 |
ttttcttttaggcaagacaaacttaattattagacatcataaaaagtacggtgattagcatagaaatgggat-gctctagctaagtgttgagcaacct |
167 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43559537 |
tttttttttaggcaagacaaacttaattattagacatcataaaaagaacggtgattagtatagaaatgggatggctctagctaagtgttgagcaacct |
43559440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 207 - 308
Target Start/End: Complemental strand, 43559440 - 43559337
Alignment:
| Q |
207 |
tcacaatctcccaattcaatcatggaaaaagaggaattgtttatccaatatgactcattgaatggaatgggcaagctgctgca--tttctgtgaggtcca |
304 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||||| |
|
|
| T |
43559440 |
tcacaatctcccaattcaatcattgataaagaggaattgtttatccaatatgactcattgaattgaatgggcaagctgctgcatgtctctgtgaggtcca |
43559341 |
T |
 |
| Q |
305 |
gttt |
308 |
Q |
| |
|
|||| |
|
|
| T |
43559340 |
gttt |
43559337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 13 - 79
Target Start/End: Complemental strand, 43559649 - 43559588
Alignment:
| Q |
13 |
aatatattaatgggtaagctatattcaaaactacacaaattatatatgcaaagtttaattttctttt |
79 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
43559649 |
aatatattaatgggta-gctatattcaaaaatacacaaattat----gcaaagtttaattttctttt |
43559588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University