View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21276_low_24 (Length: 306)
Name: NF21276_low_24
Description: NF21276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21276_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 65 - 181
Target Start/End: Complemental strand, 38015429 - 38015313
Alignment:
| Q |
65 |
ttgtgctcatgaaacaattgcacttcattaatattgggtcgaagcgtggaacattatttcttctgcaaagtgtcctatgaaagacacttcttatttgatg |
164 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38015429 |
ttgtgctcatgaaagaattgcacttcattaatattgggtcgaagtgtgaaacattagttcttctgcaaagtgtcctatgaaagacacttcttgtttgatc |
38015330 |
T |
 |
| Q |
165 |
ttgctgtctgtttgtca |
181 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38015329 |
ttgctgtctgtttgtca |
38015313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 289
Target Start/End: Complemental strand, 38015137 - 38015081
Alignment:
| Q |
227 |
acactaccatcactcccttggcccccacctctctatttctatcaatcatatcacccaccaata |
289 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38015137 |
acactaccatcactcccttggcccccacc------tttctatcaatcatatcacccaccaata |
38015081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University