View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21276_low_27 (Length: 297)
Name: NF21276_low_27
Description: NF21276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21276_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 16 - 155
Target Start/End: Complemental strand, 35382483 - 35382344
Alignment:
| Q |
16 |
agaagaaaagtcaccaaagtgaaagggaaaacaaataaataaaaaattgagttgattgagagagaataaaatccatttacttcaatatcaaggaacgtag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35382483 |
agaagaaaagtcaccaaagtgaaagggaaaacaaataaataaaaaattgagttgattgagagagaataaaatccatttacttcaatatcaaggaacgtag |
35382384 |
T |
|
| Q |
116 |
tttcactttcgcccactcaaatgaaatctaattgtgctat |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35382383 |
tttcactttcgcccactcaaatgaaatctaattgtgctat |
35382344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University