View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21276_low_37 (Length: 232)

Name: NF21276_low_37
Description: NF21276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21276_low_37
NF21276_low_37
[»] chr1 (1 HSPs)
chr1 (1-175)||(40033834-40034008)


Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 40034008 - 40033834
Alignment:
1 agcataattcaaaaacataaacgattaacacactaaaaacatagaacgatgctgaaaaagaacataaattcacaacaaataaaaactaccgattcagaca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40034008 agcataattcaaaaacataaacgattaacacactaaaaacatagaacgatgctgaaaaagaacataaattcacaacaaataaaaactaccgattcagaca 40033909  T
101 tataaacaaacatccaacgaatcaaaaggaaagacataaacttaagcataaacattattatcatgatcgaatacg 175  Q
    ||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||    
40033908 tataaacaaacatccaacgaatcaaaaggaaaagcataaacttaagcataaacattattatcatgatcgaatacg 40033834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University