View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21277_high_15 (Length: 238)
Name: NF21277_high_15
Description: NF21277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21277_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 7 - 222
Target Start/End: Original strand, 9135877 - 9136092
Alignment:
| Q |
7 |
catgttgggagtgataaaaacttcaaacgacattcgttttaaaatggaggtagtaatcaatgtatctagaaaattgattagaaatagaaaatgctactaa |
106 |
Q |
| |
|
||||||||||||||||||||| | ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
9135877 |
catgttgggagtgataaaaaccttaaacgacgttcgttttaaaatggaggtagtaatcaatgtatctagaaaattgattagaaataaaaaatgctaccaa |
9135976 |
T |
 |
| Q |
107 |
gtgtccacaaaacactctttaaggaccataaagatattgttgaatgcaaaaggtacccttttcgttgttgaaggcatgaggagttatttcaccttttaat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9135977 |
gtgtccacaaaacactctttaaggaccataaagatattgttgaatgcaaaaggtacccttttcgttgttgaagggatgaggagttatttcaccttttaat |
9136076 |
T |
 |
| Q |
207 |
gtcttcaccgaaatga |
222 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
9136077 |
gtcttcaccgaaatga |
9136092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University