View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21277_high_17 (Length: 232)
Name: NF21277_high_17
Description: NF21277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21277_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 217
Target Start/End: Original strand, 51417972 - 51418174
Alignment:
| Q |
13 |
gattatacttcactactatagctacctatcaatattcttcaatatccaaaacagcaacatcaaatcaaaccaacattctctctctttctttgcccttgtc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51417972 |
gattatacttcactactatagctacctaacaatattcttcaatatccaaaacagcaacatcaaatcaaaccaacattctctctctttctttgcccttgtc |
51418071 |
T |
 |
| Q |
113 |
ctaactttttctttcctttaaattcataggagtataactcacaagtcttccctcacaaaactaacacagatcttaaccaataatcccattgcctttgtta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51418072 |
ctaactttttctttcctttaaattcataggag--taactcacaagtcttccctcacaaaactaacacagatcttaaccaataatcccattgcctttgtta |
51418169 |
T |
 |
| Q |
213 |
caatt |
217 |
Q |
| |
|
||||| |
|
|
| T |
51418170 |
caatt |
51418174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University