View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21277_high_18 (Length: 229)
Name: NF21277_high_18
Description: NF21277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21277_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 27603383 - 27603602
Alignment:
| Q |
1 |
tggaggggacatctcttgggttgacttgtacttgcctaggttggttcagccctatgctcggcttgctcgtcttgataaaccaattggaacatggcttcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27603383 |
tggaggggacatctcttgggttgacttgtacttgcctaggttggttcagccctatgctcggcttgctcgccttgataaaccaattggaacatggcttcta |
27603482 |
T |
|
| Q |
101 |
ctatggccttgtgtgtggtaagag------tttgttttttgtgttacatatttatgggtaaatgttttcactttgacaagaacatagagaatttaacaac |
194 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||| | |||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
27603483 |
ctatggccttgtgtgtggtaagagtttttttttttttttttttttacatatttatgggtaaatgttttcaccatgacaagaacgtagagaatttaacaac |
27603582 |
T |
|
| Q |
195 |
tttattgataagaaaatggt |
214 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
27603583 |
tttattgataagaaaatggt |
27603602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 7 - 133
Target Start/End: Complemental strand, 52210965 - 52210836
Alignment:
| Q |
7 |
ggacatctcttgggttgacttgtacttgcctaggttggttcagccctatgctcggcttgctcgtcttgataaaccaattggaacatggc---ttctacta |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| || |||||||||||||| ||||||| |||| ||| |
|
|
| T |
52210965 |
ggacatctcttgggttgacttgtacttgcctaggttggttcagccttatgcccggcttgctcgcctcgataaaccaattgggacatggcttcttcttcta |
52210866 |
T |
|
| Q |
104 |
tggccttgtgtgtggtaagagtttgttttt |
133 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| |
|
|
| T |
52210865 |
tggccttgcgtgtggtaagagtttcttttt |
52210836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University