View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21277_high_6 (Length: 347)
Name: NF21277_high_6
Description: NF21277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21277_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 18 - 333
Target Start/End: Original strand, 2509090 - 2509412
Alignment:
| Q |
18 |
gttgggatatccgttttcagctcctttcttctcattgtcgccgtgaaccatctgaacaaatctcaggttcactctttatccttccctttacatccattgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2509090 |
gttgggatatccgttttcagctcctttcttctcattgtcgccgtgaaccatctgaacaaatctcaggttcactctttatccttccctttacatccattgt |
2509189 |
T |
 |
| Q |
118 |
tgactctatctattagatttatttggtgatgaaattggataaattttgaattaagttaataagctataataacctttt---aagtt--ttaacaagttag |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||| || | |
|
|
| T |
2509190 |
tgactctctctattagatttatttggtgatgaaattggataaattttgaattaagttaataagctataataaccttttaacaagctacttagtaattgtc |
2509289 |
T |
 |
| Q |
213 |
at-ttatttggcgaaattgaatcaactttgaattaaactaactt-atttcctcagtggttcaaaatagatctctattagcatttagtcctgcattattgg |
310 |
Q |
| |
|
|| ||||||||||||||||||| ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2509290 |
atattatttggcgaaattgaataaactttgaattaagctaacttaatttcctcagtggttcaaaatagatctctattagcatttagtcctgcattattgg |
2509389 |
T |
 |
| Q |
311 |
aagttcaattcatttttgttgtt |
333 |
Q |
| |
|
||||||||||||| ||||||||| |
|
|
| T |
2509390 |
aagttcaattcatgtttgttgtt |
2509412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 128 - 172
Target Start/End: Complemental strand, 13769727 - 13769683
Alignment:
| Q |
128 |
tattagatttatttggtgatgaaattggataaattttgaattaag |
172 |
Q |
| |
|
|||| ||||||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
13769727 |
tatttgatttatttggtgatgaaactagatacattttgaattaag |
13769683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University