View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21277_low_12 (Length: 250)

Name: NF21277_low_12
Description: NF21277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21277_low_12
NF21277_low_12
[»] chr7 (1 HSPs)
chr7 (1-240)||(44671227-44671466)


Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 44671227 - 44671466
Alignment:
1 aataataatcaataaaaagaaagaaattagaaaattttgaacatatacatacgtgattagatatcggaaacattattatagtacacctgcaagacgtaat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||     
44671227 aataataatcaataaaaagaaagaaattagaaaattttgaacatatacatacgtgattagatatcggaaacattattatagtacgcctgcaagacgtaac 44671326  T
101 tgaacaattaacaaaagcatgcatgaggttatatttaagtttgagattaatgctcttgtttctgnnnnnnnnnnnnnnnnngatattatgattcaaaaca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                 |||||||||||||||||||    
44671327 tgaacaattaacaaaagcatgcatgaggttatatttaagtttgagattaatgctcttgtttctgtttttgttttttgttttgatattatgattcaaaaca 44671426  T
201 cttttttacacgataatgatcacaatcctaatgacctttg 240  Q
    ||||||||||||||||||||||||||||||||||||||||    
44671427 cttttttacacgataatgatcacaatcctaatgacctttg 44671466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University