View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21277_low_7 (Length: 287)
Name: NF21277_low_7
Description: NF21277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21277_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 65 - 250
Target Start/End: Complemental strand, 32866139 - 32865954
Alignment:
| Q |
65 |
aaccaatgatgcagcacctgcaaccctcatttccnnnnnnngtttgatataaattttttagggtaaagaccaagtccaagaaaggagatcataaagctca |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32866139 |
aaccaatgatgcagcacctgcaaccctcatttcctttttttgtttgatataaaatttttagggtaaagaccaagtccaagaaaggagatcatagagctca |
32866040 |
T |
|
| Q |
165 |
atgaacactcaaacgaatttaactttacttctccatgaggatactgccgaaactcaaatataaaacttccaaattcaaaatttgac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32866039 |
atgaacactcaaacgaatttaactttacttctccatgaggatactgccgaaactcaaatataaaacttccaaattcaaaatttgac |
32865954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 32866169 - 32866207
Alignment:
| Q |
17 |
ttggactttgaattatatgaagccctttttctttcctac |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32866169 |
ttggactttgaattatatgaagccctttttctttcctac |
32866207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University