View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21278_high_7 (Length: 234)
Name: NF21278_high_7
Description: NF21278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21278_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 39996694 - 39996896
Alignment:
| Q |
20 |
gttaacgaggattgtgcttcgatgaattgaacacccaatgagttgcattcaagatcaaaacgaccatttcctttcgagtgtaaacgaccggcaagtggat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39996694 |
gttaacgaggattgtgcttcgatgaattgaacacccaatgagttgcattcgagatcaaaacgaccatttcctttcgagtgtaaacgaccggcaagtggat |
39996793 |
T |
 |
| Q |
120 |
aaaacggcacaaggactttgcttaatgactctttcaaagtggtggcgattttagtgggggagggaagccagttttttgggggctggtaaaagtatattct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |
|
|
| T |
39996794 |
aaaacggcacaaggactttgcttaatgactctttcaaagtggtggcgattttagtgggggaggtaagccagttttttgggggctggtaaaagtatattgt |
39996893 |
T |
 |
| Q |
220 |
tgg |
222 |
Q |
| |
|
||| |
|
|
| T |
39996894 |
tgg |
39996896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 20 - 213
Target Start/End: Complemental strand, 53036901 - 53036708
Alignment:
| Q |
20 |
gttaacgaggattgtgcttcgatgaattgaacacccaatgagttgcattcaagatcaaaacgaccatttcctttcgagtgtaaacgaccggcaagtggat |
119 |
Q |
| |
|
|||||||| |||| |||||||||||||||| ||||||||||||||||||| | |||||||||||| || ||||| | |||||||||||||| ||||||| |
|
|
| T |
53036901 |
gttaacgacgattctgcttcgatgaattgagcacccaatgagttgcattcgacatcaaaacgaccgctttctttccattgtaaacgaccggctagtggat |
53036802 |
T |
 |
| Q |
120 |
aaaacggcacaaggactttgcttaatgactctttcaaagtggtggcgattttagtgggggagggaagccagttttttgggggctggtaaaagta |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||| |||||| |||| |||||| |||||||||| |
|
|
| T |
53036801 |
aaaacggcacaaggactttgctcaatgagtctttcaaagtggtggcgattttattgggggaggtaagccatttttgtggggggcggtaaaagta |
53036708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University