View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21279_high_29 (Length: 397)
Name: NF21279_high_29
Description: NF21279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21279_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 20 - 380
Target Start/End: Complemental strand, 52972722 - 52972362
Alignment:
| Q |
20 |
gcatggacgtaacatttccgacnnnnnnntcgtcaatcaatgtctcaatgtcgtcgggatgatactttatgtacttgtcaatatgtcttcctgtttctag |
119 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52972722 |
gcatggacgtaacatttccaacaaaaaaatcgtcaatcaatgtctcaatgtcgtcgggatgatactttatgtacttgtcaatatgtcttcctgtttctag |
52972623 |
T |
|
| Q |
120 |
atgatgtttaaatcttcccataaaggagcgatacgcaggtatgaccaaggcagatattgaaactcttaactctgattgaagttgttcatcgctcaccatc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52972622 |
atgatgtttaaatcttcccataaaggagcgatacgcaggtatgaccaaggcagatattgaaactcttaactctgattgaagttgttcatcgctcaccatc |
52972523 |
T |
|
| Q |
220 |
caactactttgcgtcttgtggatatcttcaaacatggaattgaaacacttaaacctctctctcaaaacctgcttagacaccttgttcccttgttgatgaa |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52972522 |
caactactttgcgtcttgtggatatcttcaaacatggaattgaaacacttaaacctctctctcaaaacctgcttagagaccttgttcccttgttgatgaa |
52972423 |
T |
|
| Q |
320 |
ggccatctgggttaaggcactgcaacaccttagtccaagtctctctctgataactcttatg |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52972422 |
ggccatctgggttaaggcactgcaacaccttagtccaagtctctctctgataactcttatg |
52972362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University