View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21279_high_37 (Length: 253)
Name: NF21279_high_37
Description: NF21279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21279_high_37 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 15 - 253
Target Start/End: Complemental strand, 34896569 - 34896331
Alignment:
| Q |
15 |
atgaacacttacatcgcaaaaaattgatcatgcagggaggagtgggtttgagaatcagagtctacgataggataatgtgctttgtgaattgtcacttggc |
114 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34896569 |
atgaacacttacatcgcaaaaaaatgatcatgcagggaggagtgggtttgagaatcagagtctacgataggataatgtgctttgtgaattgtcacttggc |
34896470 |
T |
 |
| Q |
115 |
agcacatttggaagctgttaatcggcgaaacgctgattttgatcacatttataagaatatggtcttcagccgatcatccactctacttaatactgcagct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34896469 |
agcacatttggaagctgttaatcggcgaaacgctgattttgatcacatttataagaatatggtcttcagccgatcatccactctacttaatactgcagct |
34896370 |
T |
 |
| Q |
215 |
ggtatgctaccatacctgttcttgtattgctctcttgcc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34896369 |
ggtatgctaccatacctgttcttgtattgctctcttgcc |
34896331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University