View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21279_high_44 (Length: 220)
Name: NF21279_high_44
Description: NF21279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21279_high_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 9521192 - 9521139
Alignment:
| Q |
1 |
ataactaatttgactcgaacaaagactcaaaaataatcaaataatcaccattgt |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
9521192 |
ataactaatttgactcgaacaaagactcaaaatcaatcaagtaatcaccattgt |
9521139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University