View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21279_high_46 (Length: 210)
Name: NF21279_high_46
Description: NF21279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21279_high_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 19 - 192
Target Start/End: Complemental strand, 51486002 - 51485828
Alignment:
| Q |
19 |
aagaaatcgggacataaaaagtgtgcaagtgataaatggcctcaacaatttgcaagaaataatatgttcaacccatcatgctgatattgtatnnnnnnng |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
51486002 |
aagaaatcgggacataaaaagtgtgcaagtgataaatggcctcaacaatttgcaagaaataatatgttcaacccatcatgctgatattgtataaaaaaag |
51485903 |
T |
 |
| Q |
119 |
tcattgcatttaatatttnnnnnnnnnctgacatgtgctcaatacg-taaatgataaccatactgattcaagctt |
192 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
51485902 |
tcattgcatttaatatttttaaaaaaactgacatatgctcaatacgttaaatgataaccatactgattcaagctt |
51485828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University