View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21279_low_25 (Length: 416)
Name: NF21279_low_25
Description: NF21279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21279_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 13 - 398
Target Start/End: Complemental strand, 4142495 - 4142113
Alignment:
| Q |
13 |
aatatcatagaatttttgggccatttctnnnnnnntccatacgaaacgggtcacggagctccgttattaccatacaaaataacacagtttatagaatagg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4142495 |
aatatcatagaatttttgggccatttctaaaaaaatccatacgaaacgggtcacggagctccgttattaccatacaaaataacacagtttatagaatagg |
4142396 |
T |
 |
| Q |
113 |
gttttgtcttcagctctgaacccacccacctacggcggaacttatctctgaggagtgaagagcagattctgcagaagacttcaacatggttcgttacctt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4142395 |
gttttgtcttcagctctgaacccacccacctacggcggaacttatctctgaggagtgaagagcagattctgcagaagacttcaacatggttcgttacctt |
4142296 |
T |
 |
| Q |
213 |
ttcctcttcaatttctcaattcttttttattattattgttgctgctgcattgtgcttattatgtttttattgaaagaaatgtataagttcttaattatta |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4142295 |
ttcctcttcaatttctcaattcttttttat---tattgttgttgctgcattgtgcttattatgtttttattgaaagaaatgtataagttcttaattatga |
4142199 |
T |
 |
| Q |
313 |
tgatatcattaacatgcatggttataatatgaggttgattaatttgatgaaaagtttcatttaaactagtcatgttataacatatg |
398 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4142198 |
tgatatcattaacatgcatggttataacatgaggttgattaatttgatgaaaagttgcatttaaactagtcatgttataacatatg |
4142113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University