View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21279_low_30 (Length: 369)
Name: NF21279_low_30
Description: NF21279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21279_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 40 - 351
Target Start/End: Original strand, 37702263 - 37702574
Alignment:
| Q |
40 |
accaccataactaacaccaacaacattcattctcctcacacaatgcgcttccatgagagcagcaacacactgagcttgaaaagattcggttcgattaggt |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37702263 |
accaccataactaacaccaacaacattcattctcctcgcacaatgcgcttccatgagagcagcaacacactgagcttgaaaagattcggttcgattaggt |
37702362 |
T |
|
| Q |
140 |
ttagaggtgtgagcctcaccgaagaagagaagatcgggaacgtagaggttgaaacgacgagtgagttgggaaatgaattcgttccattgccacattgcgt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37702363 |
ttagaggtgtgagcctcaccgaagaagagaagatcgggaacgtagatgttgaaacgacgagtgagttgggagatgaattcgttccattgccacattgcgt |
37702462 |
T |
|
| Q |
240 |
tagcgcccatgccatggagaagtagaagagagggtttgttgggtttgtgggatttgggaacccagcagtgcatgatggtggtgttgccgagaccggtggt |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37702463 |
tagcgcccatgccatggagaagtagaagagagggtttgttgggtttgtgggatttgggaacccagcagtgcatgatggtggtgttgccgagaccggtggt |
37702562 |
T |
|
| Q |
340 |
agttgatttgag |
351 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37702563 |
agttgatttgag |
37702574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 61; Significance: 4e-26; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 41 - 181
Target Start/End: Original strand, 16511493 - 16511633
Alignment:
| Q |
41 |
ccaccataactaacaccaacaacattcattctcctcacacaatgcgcttccatgagagcagcaacacactgagcttgaaaagattcggttcgattaggtt |
140 |
Q |
| |
|
||||||||||||||||||||||||| || || ||||||| ||| ||| ||||||||||||||||||||||||||||||||| | | | |||| |||| |
|
|
| T |
16511493 |
ccaccataactaacaccaacaacatacaaacttctcacaccatgtgctcccatgagagcagcaacacactgagcttgaaaagctacagatcgaacaggta |
16511592 |
T |
|
| Q |
141 |
tagaggtgtgagcctcaccgaagaagagaagatcgggaacg |
181 |
Q |
| |
|
|| |||||||| || ||||||||||||||||| |||||| |
|
|
| T |
16511593 |
aagtggtgtgagattcgccgaagaagagaagatcaggaacg |
16511633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University