View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21279_low_42 (Length: 230)
Name: NF21279_low_42
Description: NF21279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21279_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 19 - 212
Target Start/End: Original strand, 37278131 - 37278324
Alignment:
| Q |
19 |
atgtatacttgatatattacacaaccaacaagtaataaaaattcatagtgcttgcttcttacactatctttaatatattagtagattgtccgtataggat |
118 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37278131 |
atgtatacttgatatgttacacaacccacaagtaataaaaattcatagtgcttgcttcttacactatctttaatatattagtggattgtccgtataggat |
37278230 |
T |
 |
| Q |
119 |
tcatgtatagtgactctaattnnnnnnngaattaatagaacataactagaacaaatgtaaaattccaaaagccagggacaaccattcaacatac |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37278231 |
tcatgtatagtgactctaattaaaaaaagaattaatagaacataactagaacaaatgtaaaattccaaaagccagggacaactattcaacatac |
37278324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University