View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21279_low_44 (Length: 223)

Name: NF21279_low_44
Description: NF21279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21279_low_44
NF21279_low_44
[»] chr6 (1 HSPs)
chr6 (20-205)||(32375226-32375411)


Alignment Details
Target: chr6 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 20 - 205
Target Start/End: Original strand, 32375226 - 32375411
Alignment:
20 gaaccataccattaaaatgaaaagtttctgtaaactccctaagaacttcgaggtaaaaaccatcagggtcaccaagatattcgccgagcgcctttttgtc 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
32375226 gaaccataccattaaaatgaaaagtttctgtaaactccctaagaacttcgaggtaaaaactatcagggtcaccaagatattcgccgagcgcctttttgtc 32375325  T
120 tagaccaggtgtgaaccggaagaagtaagcatacgacttcggatcaggaggatcggagattaacttagcatgcttcaagtactcta 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32375326 tagaccaggtgtgaaccggaagaagtaagcatacgacttcggatcaggaggatcggagattaacttagcatgcttcaagtactcta 32375411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University