View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21279_low_47 (Length: 211)
Name: NF21279_low_47
Description: NF21279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21279_low_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 17 - 63
Target Start/End: Complemental strand, 42325591 - 42325545
Alignment:
| Q |
17 |
atattattggaatttagtttgatttcttataagatattagtgataat |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42325591 |
atattattggaatttagtttgatttcttataagatattagagataat |
42325545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 189
Target Start/End: Complemental strand, 42315831 - 42315791
Alignment:
| Q |
149 |
tccacctcattgtaggactctggacaaatgaaaggcttttt |
189 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
42315831 |
tccaccacattgtaggactcaggacaaatgaaaggcttttt |
42315791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University