View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2127_high_7 (Length: 224)
Name: NF2127_high_7
Description: NF2127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2127_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 104 - 207
Target Start/End: Original strand, 26308769 - 26308872
Alignment:
| Q |
104 |
gagcctcttcacgagtggtcattttagaaggacccaaaatacaagtgaacatacttaaaggaattactaggatgatgcttatcactcctaaacttaacct |
203 |
Q |
| |
|
||||||| ||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26308769 |
gagcctccccacgagtagtcactttagaaggacccaaaatacaagtgaacatacttaaaggaattactaggatgatgcttatcactcctaaacttaaccc |
26308868 |
T |
 |
| Q |
204 |
tata |
207 |
Q |
| |
|
|||| |
|
|
| T |
26308869 |
tata |
26308872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 15 - 79
Target Start/End: Original strand, 26308682 - 26308746
Alignment:
| Q |
15 |
caaaggtgtcacttttatgttatataatatgaattcgtactcttctagaataatcatcaatcatg |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26308682 |
caaaggtgtcacttttatgttatataatatgaattcgtactcttctagaataatcatcaatcatg |
26308746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 16 - 74
Target Start/End: Complemental strand, 36295405 - 36295347
Alignment:
| Q |
16 |
aaaggtgtcacttttatgttatataatatgaattcgtactcttctagaataatcatcaa |
74 |
Q |
| |
|
|||||||||||||||||||| || ||| |||| || ||||||||||||||||||||||| |
|
|
| T |
36295405 |
aaaggtgtcacttttatgttttaaaatgtgaactcatactcttctagaataatcatcaa |
36295347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University