View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2127_low_8 (Length: 237)
Name: NF2127_low_8
Description: NF2127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2127_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 19376703 - 19376503
Alignment:
| Q |
1 |
atattaaaatcttcttagattacttgctatacgatctttaaaattgaattactcgggttacactttaaatgttgagtcttggatgtgatgaaggtgttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19376703 |
atattaaaatcttcttagattacttgctatacgatctttaaaattgaattactcgggttacactttaaatgttgagtcttggatgtgatgaaggtgttac |
19376604 |
T |
|
| Q |
101 |
gagtcttataaaagtgatatggctatgataattattataagaaaatgctaacgagtgtcattagaatattctttaacaaccttaaaatggtaaaattaaa |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||| ||||||||| ||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19376603 |
gagtcttataaaaatgatatggctatgataattattttaaagaaatgctaaggagtgtcgttagaatattctttaacaatcttaaaatggtaaaattaaa |
19376504 |
T |
|
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
19376503 |
t |
19376503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University