View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2127_low_9 (Length: 236)
Name: NF2127_low_9
Description: NF2127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2127_low_9 |
 | |
|
| [»] scaffold0370 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 139 - 221
Target Start/End: Complemental strand, 38692176 - 38692094
Alignment:
| Q |
139 |
gcctctgaatttgacatctcatcaaggactcttacatcttttttcttcactcagttgatgtactttatttattagtgaacaat |
221 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38692176 |
gcctctgaacttgacatctcatcaaggactcttacatcttttttcttcactcagttgatgtactttatttattagtgaacaat |
38692094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 222
Target Start/End: Complemental strand, 38634439 - 38634358
Alignment:
| Q |
140 |
cctctgaatttgacatctcatcaaggactcttacatcttttttcttcactcagttgatgtactttatttattagtgaacaatg |
222 |
Q |
| |
|
|||||||||||||||||||||| ||| | ||||||| |||||||| ||| ||||| ||||||||||| ||||||||||| |
|
|
| T |
38634439 |
cctctgaatttgacatctcatctagggttgatacatct-ttttcttctgccagctgatggactttatttataagtgaacaatg |
38634358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 13648 - 13568
Alignment:
| Q |
140 |
cctctgaatttgacatctcatcaaggactcttacatcttttttcttcactcagttgatgtactttatttattagtgaacaat |
221 |
Q |
| |
|
|||||||| |||||||||||||||||| | |||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13648 |
cctctgaacttgacatctcatcaaggagtgttacatcttttt-cttcactcagttgatgtactttatttataagtgaacaat |
13568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University