View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21280_high_39 (Length: 203)
Name: NF21280_high_39
Description: NF21280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21280_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 194
Target Start/End: Complemental strand, 10059203 - 10059027
Alignment:
| Q |
18 |
attcaaacaatcaacacattagtcgctattaaattaaaatcctaaacactaaatctagaccatccaatctatatttaatgatcatcaatgtactaactgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10059203 |
attcaaacaatcaacacattagtcgctattaaattaaaatcctaaacactaaatctagaccatccaatctatatttaatgatcatcaatgtactgactgt |
10059104 |
T |
 |
| Q |
118 |
gtgaatgcatacgactgtgactacaaacaatcaaaattccttcttctctagcttctttggatgagcctatgctactt |
194 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10059103 |
gtgaatgcatacaactatgactacaaacaatcaaaattctttcttctctagcttctttggatgagcctatgcaactt |
10059027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University